QTJD effects on macrophage polarization and inflammatory response

Exploratory Score: 0.950 Price: $0.50 Mycoplasma pneumoniae pneumonia Primary mouse lung and bone marrow macrophages Status: proposed

What This Experiment Tests

Exploratory experiment designed to discover new patterns targeting CD86, CXCL10, CD206, ARG1, MRC1 in Primary mouse lung and bone marrow macrophages. Primary outcome: Macrophage polarization markers (M1 vs M2 phenotype)

Description

Primary mouse lung and bone marrow cells were isolated to examine the effects of QTJD-containing serum on macrophage polarization in response to Mycoplasma pneumoniae infection. The study investigated how QTJD modulates macrophage polarization from the pro-inflammatory M1 phenotype to the anti-inflammatory M2 phenotype through butyric acid. Cell viability assays, flow cytometry, and quantitative reverse transcription-PCR were performed to assess macrophage phenotype markers. The experiment demonstrated that QTJD reduced M1 markers (CD86, CXCL10) and enhanced M2 markers (CD206, Arg-1, MRC-1), promoting beneficial M2 polarization and alleviating inflammatory responses.

TARGET GENE

CD86, CXCL10, CD206, ARG1, MRC1

MODEL SYSTEM

Primary mouse lung and bone marrow macrophages

ESTIMATED COST

TIMELINE

0 months

PATHWAY

Macrophage polarization pathway

SOURCE

extracted_from_pmid_41754753

PRIMARY OUTCOME

Macrophage polarization markers (M1 vs M2 phenotype)

Scoring Dimensions

📖 Wiki Pages

MRC1 — Mannose Receptor C Type 1gene CXCL10 - C-X-C Motif Chemokine Ligand 10gene ARG1 — Arginase 1gene ARG1 Proteinprotein MRC Laboratory of Molecular Biologyinstitution Kynurenine Pathway Modulators for Neurodegeneratiotherapeutic Inflammatory Astrocytescell Microgliacell A1 Reactive Astrocytescell cGAS-STING Pathway Inhibition for Chronic Neuroinfidea Interferon Signaling in Neurodegenerationmechanism Microglia CD8+ T Cell Recruitment in White Matter mechanism Microglia CD8+ T Cell Recruitment -- Supplementarymechanism PSP Peripheral Immune Dysfunctionmechanism cGAS-STING Inhibitor Therapy for Neurodegenerationtherapeutic

Protocol

PHASE 1: Macrophage Isolation and Culture (Day 0-2)

1.1 Bone Marrow-Derived Macrophages (BMDMs)

Euthanize 8-12 week old C57BL/6 mice via CO2 inhalation followed by cervical dislocation
Harvest femurs and tibias aseptically
Flush bone marrow with RPMI-1640 medium containing 10% FBS, 1% penicillin-streptomycin
Filter through 70 μm cell strainer, centrifuge at 300×g for 5 min
Resuspend in complete RPMI-1640 supplemented with 10 ng/mL M-CSF (PeproTech, #300-25)
Culture in 10 cm bacterial petri dishes for 7 days at 37°C, 5% CO2
Replace media on Day 3 and Day 5
Harvest differentiated macrophages (CD11b+ F4/80+) on Day 7

...

PHASE 1: Macrophage Isolation and Culture (Day 0-2)

1.1 Bone Marrow-Derived Macrophages (BMDMs)

Euthanize 8-12 week old C57BL/6 mice via CO2 inhalation followed by cervical dislocation
Harvest femurs and tibias aseptically
Flush bone marrow with RPMI-1640 medium containing 10% FBS, 1% penicillin-streptomycin
Filter through 70 μm cell strainer, centrifuge at 300×g for 5 min
Resuspend in complete RPMI-1640 supplemented with 10 ng/mL M-CSF (PeproTech, #300-25)
Culture in 10 cm bacterial petri dishes for 7 days at 37°C, 5% CO2
Replace media on Day 3 and Day 5
Harvest differentiated macrophages (CD11b+ F4/80+) on Day 7

1.2 Lung-Associated Macrophages (LAMs)

Perfuse mouse lungs with PBS via cardiac puncture
Digest lung tissue with collagenase D (2 mg/mL, Roche, #11088882001) and DNase I (50 μg/mL, Sigma, #DN25) in HBSS at 37°C for 45 min
Disrupt tissue through 70 μm strainer
Enrich macrophages using CD11b MicroBeads (Miltenyi, #130-049-601) per manufacturer protocol
Culture in RPMI-1640 with 10% FBS, 20 ng/mL M-CSF for 48 h prior to treatment

PHASE 2: QTJD Preparation and Treatment (Day 7-9)

2.1 QTJD Solution Preparation

Dissolve QTJD (provided as lyophilized powder, stored at -80°C) in DMSO to create 10 mM stock
Further dilute in complete RPMI-1640 to working concentrations: 1 μM, 5 μM, 10 μM
Final DMSO concentration ≤0.1% in all treatments

2.2 Macrophage Treatment

Seed BMDMs and LAMs in 12-well plates at 5×10^5 cells/well
Allow to adhere overnight
Treat cells with:
Vehicle control: 0.1% DMSO in complete media
QTJD low: 1 μM QTJD
QTJD medium: 5 μM QTJD
QTJD high: 10 μM QTJD
Positive control (M1): 100 ng/mL LPS (Sigma, #L2630) + 20 ng/mL IFN-γ (PeproTech, #315-05)
Positive control (M2): 20 ng/mL IL-4 (PeproTech, #214-14) + 20 ng/mL IL-13 (PeproTech, #210-13)
Incubate for 24 h (M1 polarization) or 48 h (M2 polarization) at 37°C, 5% CO2

PHASE 3: M1/M2 Polarization Induction with Mycoplasma Antigen (Day 8-10)

3.1 Mycoplasma pneumoniae Antigen Preparation

Use commercially available M. pneumoniae membrane protein antigen (Austral Biologicals, #P-100-10)
Reconstitute in PBS at 1 mg/mL, sonicate briefly to disaggregate

3.2 Co-treatment Protocol

On Day 8, replace culture medium with fresh complete RPMI-1640
Co-treat macrophages with QTJD (5 μM, EC50 concentration) + M. pneumoniae antigen (10 μg/mL)
Include appropriate single-treatment controls
Incubate for additional 24 h
Collect supernatant for cytokine analysis, freeze at -80°C
Harvest cells for RNA/protein analysis

PHASE 4: Gene Expression Analysis (Day 9-11)

4.1 RNA Extraction

Extract total RNA using RNeasy Mini Kit (Qiagen, #74104) per manufacturer protocol
Quantify using NanoDrop 2000 (Thermo Fisher)
Ensure A260/A280 ratio >1.9, A260/A230 >2.0
Store RNA at -80°C

4.2 RT-qPCR

Synthesize cDNA using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, #4368814)
Perform qPCR using Power SYBR Green PCR Master Mix (Applied Biosystems, #4367659)
Primer sequences (5'→3'):
CD86: F: GGCTACCACTGAAAAACCCC, R: CAGACGGTGTCTTAGCTCGG
CXCL10: F: ATGACGGGCCAGTGAGAAT, R: TCTTCCCTATGGCCCTCATT
CD206 (MRC1): F: GCATCTGGCTCTGGCTCTTT, R: CCTGATCCCAGTGTTCCAGA
ARG1: F: CTCCAAGCCAAAGTCCTTAGAG, R: AGGAGCTGTCATTAGGGACATC
GAPDH: F: AACTTTGGCATTGTGGAAGG, R: ACACATTGGGGGTAGGAACA
Run on Applied Biosystems 7500 Fast Real-Time PCR System
Analyze using 2^-ΔΔCt method, normalize to GAPDH

PHASE 5: Protein Expression and Flow Cytometry (Day 10-11)

5.1 Surface Marker Staining

Harvest cells using accutase (Sigma, #A6964), wash in PBS
Block Fc receptors with CD16/32 antibody (BD, #553142) for 10 min at 4°C
Stain with fluorochrome-conjugated antibodies:
CD86-PE (BD, #553691, 1:100)
CD206-FITC (BioLegend, #141004, 1:100)
F4/80-APC (BioLegend, #123116, 1:100)
CD11b-PerCP-Cy5.5 (BD, #550993, 1:100)
Incubate 30 min at 4°C in the dark
Wash twice with FACS buffer (PBS + 2% FBS)
Resuspend in 300 μL FACS buffer + 1% paraformaldehyde

5.2 Intracellular Staining (ARG1)

Fix cells with 4% paraformaldehyde for 15 min at RT
Permeabilize with 0.1% Triton X-100 for 10 min
Block with 5% normal goat serum
Stain with ARG1-Alexa Fluor 647 (R&D Systems, #IC5868A, 1:50) or appropriate primary + secondary
Analyze within 24 h

5.3 Flow Cytometry Acquisition

Acquire on BD LSRFortessa X-20 with FACSDiva software
Gate on live cells (forward/side scatter), then CD11b+ F4/80+ population
Analyze 10,000 events per sample
Data analysis using FlowJo v10.8.1

PHASE 6: Cytokine and Functional Assays (Day 10-12)

6.1 Cytokine Profiling

Analyze culture supernatant using LEGENDplex Mouse Macrophage/Microglia Panel (BioLegend, #740846)
Measure: TNF-α, IL-6, IL-10, IL-12p70, CXCL10, CCL17, CCL22
Run on BD LSRFortessa, analyze with LEGENDplex software

6.2 Phagocytosis Assay

Label heat-killed E. coli bioparticles with Alexa Fluor 594 (Thermo Fisher, #E35372)
Incubate macrophages with opsonized bioparticles (10:1 ratio) for 1 h at 37°C
Quench with trypan blue, wash, analyze by flow cytometry
Report as mean fluorescence intensity (MFI)

6.3 Nitric Oxide (NO) Production

Measure nitrite accumulation using Griess Reagent System (Promega, #G2930)
Mix 50 μL supernatant with equal volume sulfanilamide solution and NED solution
Read at 540 nm on Synergy H1 microplate reader
Quantify against sodium nitrite standard curve

Expected Outcomes

CD86 mRNA expression: QTJD treatment will increase CD86 transcript levels by 2.8 ± 0.4-fold at 5 μM compared to vehicle control (p < 0.01, n = 6 biological replicates), as measured by RT-qPCR after 24 h treatment.

CXCL10 secretion: M. pneumoniae antigen stimulation in presence of QTJD (5 μM) will elevate CXCL10 protein in supernatant to 847 ± 95 pg/mL versus 312 ± 48 pg/mL in antigen-only control (p < 0.001, n = 5).

...

Success Criteria

RT-qPCR validation: CD86 upregulation ≥2.5-fold and CD206/MRC1 downregulation ≤0.4-fold in QTJD-treated (5 μM) versus vehicle (DMSO) at 24 h, with p < 0.01 by unpaired two-tailed t-test, effect size (Cohen's d) > 1.2
Flow cytometry confirmation: ≥75% of CD11b+ F4/80+ cells co-express CD86 at high levels (MFI > 3000) after QTJD treatment, with <15% showing CD206 high phenotype, verified in ≥3 independent experiments

...

Related Hypotheses (3)

White Matter Oligodendrocyte Protection via CXCL10 Inhibition0.675

White Matter Vulnerability Prevention via Oligodendrocyte Protection0.667

White Matter Immune Checkpoint Restoration0.644

Debate History (0)

No debates yet

Experiment Results (0)

No results recorded yet. Use POST /api/experiments/{id}/results to record a result.