IDH1 and IDH2 mutation sequencing in CNS and non-CNS tumors

Exploratory Score: 0.950 Price: $0.50 gliomas (astrocytomas, oligodendrogliomas, glioblastomas) human tumor samples Status: proposed

What This Experiment Tests

Exploratory experiment designed to discover new patterns targeting IDH1, IDH2 in human tumor samples. Primary outcome: frequency and distribution of IDH1 and IDH2 mutations

Description

A comprehensive sequencing study to determine the frequency and distribution of IDH1 and IDH2 mutations across different grades and types of gliomas and other tumors. The study sequenced both IDH1 and IDH2 genes in 445 central nervous system tumors and 494 non-CNS tumors to identify mutations, particularly focusing on amino acid positions 132 in IDH1 and 172 in IDH2. The research aimed to characterize the mutational landscape of these isocitrate dehydrogenase genes across different tumor types and grades, building on previous genome-wide mutational analysis that had identified IDH1 mutations in glioblastomas. The study found that mutations affecting amino acid 132 of IDH1 occurred in more than 70% of WHO grade II and III astrocytomas and oligodendrogliomas, as well as in secondary glioblastomas that developed from these lower-grade lesions.

TARGET GENE

IDH1, IDH2

MODEL SYSTEM

human tumor samples

ESTIMATED COST

TIMELINE

0 months

PATHWAY

NADP(+)-dependent isocitrate dehydrogenase pathway

SOURCE

extracted_from_pmid_19228619

PRIMARY OUTCOME

frequency and distribution of IDH1 and IDH2 mutations

Scoring Dimensions

📖 Wiki Pages

IDH1 Gene - Isocitrate Dehydrogenase 1gene IDH1 Protein - Isocitrate Dehydrogenase 1protein CNS Lymphatic and Meningeal Immunity in 4R-Tauopatmechanism CNS Vasculitisdisease CNS-Selective NLRP3 Inflammasome Inhibitoridea idh2gene CNS Border-Associated Macrophages (BAMs)cell CNS Drug Delivery Methodsmechanism Sirtuin Pathway Dysfunction Hypothesis in Parkinsohypothesis Ventral Tegmental Area Dopamine Neurons in Neurodecell Epigenetic Dysregulation Validation in Parkinson'sexperiment Epigenetic Biomarkers in Neurodegenerative Diseasebiomarker Epigenetic Regulation Dysfunction in Alzheimer's aexperiment Epigenetic Clocks in Neurodegeneration — Causal Drexperiment Medial Forebrain Bundle in Neurodegenerationcell

Protocol

IDH1 and IDH2 Mutation Sequencing in CNS and Non-CNS Tumors

PHASE 1: Sample Acquisition and Pathological Validation (Day 1-7)

1.1 Sample Collection

Collect formalin-fixed paraffin-embedded (FFPE) tumor samples from archived tissue banks
Minimum: 50 mg tissue per sample; macro-dissection for >70% tumor cellularity
Include CNS tumors (astrocytomas WHO grade II-IV, oligodendrogliomas, glioblastomas) and non-CNS tumors (colorectal carcinoma, acute myeloid leukemia, cholangiocarcinoma) as comparator cohort
Collect corresponding adjacent normal tissue (when available) as germline control

...

IDH1 and IDH2 Mutation Sequencing in CNS and Non-CNS Tumors

PHASE 1: Sample Acquisition and Pathological Validation (Day 1-7)

1.1 Sample Collection

Collect formalin-fixed paraffin-embedded (FFPE) tumor samples from archived tissue banks
Minimum: 50 mg tissue per sample; macro-dissection for >70% tumor cellularity
Include CNS tumors (astrocytomas WHO grade II-IV, oligodendrogliomas, glioblastomas) and non-CNS tumors (colorectal carcinoma, acute myeloid leukemia, cholangiocarcinoma) as comparator cohort
Collect corresponding adjacent normal tissue (when available) as germline control

1.2 Histopathological Review

H&E staining of 5 μm sections for neuropathologist confirmation
Tumor cellularity quantification via ImageJ densitometry (threshold: ≥40% tumor nuclei)
WHO classification and grade assignment per current Classification of CNS Tumors

Reagents/Equipment:

Ethanol (100%, 95%), xylene, hematoxylin, eosin Y
Microtome (Leica RM2235), coverslips, slides

PHASE 2: Nucleic Acid Extraction and Quality Control (Day 8-10)

2.1 Genomic DNA Extraction

Use QIAamp DNA FFPE Tissue Kit (Qiagen, 56404)
Deparaffinization: 1 mL xylene, 55°C, 3 min; repeat twice
Proteinase K digestion: 20 μL proteinase K (20 mg/mL), 56°C, 1 h, then 90°C, 1 h
DNA binding: column binding, 600 μL AW1 wash, 700 μL AW2 wash
Elution: 30 μL ATE buffer, 56°C, 5 min; repeat with 20 μL

2.2 RNA Extraction (optional for expression analysis)

RNeasy FFPE Kit (Qiagen, 73504)

2.3 Quality Control

Quantify DNA concentration: Qubit 4.0 Fluorometer (Thermo Fisher) with Qubit dsDNA HS Assay Kit
Measure260/280 and 260/230 ratios: NanoDrop 2000
Acceptable ranges: 260/280 ≥1.8; 260/230 ≥1.5
Fragment analysis: Agilent 4200 TapeStation with Genomic DNA ScreenTape
Minimum requirement: DIN (DNA Integrity Number) ≥3.0 or >300 bp median fragment length

Reagents/Equipment:

QIAamp DNA FFPE Tissue Kit, Qubit 4.0, NanoDrop 2000, Agilent 4200 TapeStation

PHASE 3: PCR Amplification of IDH1 and IDH2 Hotspot Regions (Day 11-12)

3.1 Target Region Selection

IDH1: Exon 4, codon 132 (GRCh37 chr2:209113112-209113228)
IDH2: Exon 4, codon 172 (GRCh37 chr15:90088500-90088650)

3.2 Primer Design
Synthesize primers with M13 tails for Sanger sequencing:

| Gene | Forward Primer (5'→3') | Reverse Primer (5'→3') | Amplicon Size |
|------|------------------------|------------------------|---------------|
| IDH1 R132 | TGTGGTTTGTAAAGTGTGCC | AAGCCCATCACCATTGTTACC | 187 bp |
| IDH2 R172 | TGGTGAGTGGATGGGTAAAC | ACTGACCACTGTTACCCTGC | 189 bp |

3.3 PCR Reaction Setup

Template: 50-200 ng genomic DNA
KAPA HiFi HotStart PCR Kit (KAPA Biosystems, KK2502)
Final reaction volume: 25 μL
Cycling conditions:
95°C, 3 min (initial denaturation)
98°C, 20 sec × 35 cycles
60°C (IDH1) or 58°C (IDH2), 15 sec
72°C, 30 sec
72°C, 2 min (final extension)

3.4 PCR Optimization

Gradient PCR if non-specific amplification observed (annealing temperature gradient: 58-68°C)
Include positive control: DNA from BT142 cells (IDH1 R132H mutant) or U87 MG cells transfected with mutant plasmid
Include no-template control (NTC): sterile water

Reagents/Equipment:

KAPA HiFi HotStart PCR Kit, thermal cycler (Bio-Rad CFX96), gel electrophoresis system, 100 bp DNA ladder

PHASE 4: Sequencing Library Preparation and Sequencing (Day 13-16)

4.1 Agarose Gel Electrophoresis Validation

2% agarose gel, 100 V, 40 min
Visualize with GelRed stain under UV transilluminator
Expected: single band at expected amplicon size

4.2 Sanger Sequencing (Gold Standard Validation)

Purify PCR products: ExoSAP-IT Express (Thermo Fisher, 75001)
Cycle sequencing: BigDye Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher, 4337456)
Sequencing reaction: 96°C, 1 min × 25 cycles (96°C, 10 sec; 50°C, 5 sec; 60°C, 2 min)
Ethanol/EDTA precipitation: 3M sodium acetate, 125 mM EDTA, 100% ethanol
Capillary electrophoresis: Applied Biosystems 3730xl DNA Analyzer

4.3 Next-Generation Sequencing (NGS) Panel (Optional)

For comprehensive panel: Illumina TruSight Tumor 15 or custom IDH1/IDH2 assay
Library preparation: KAPA HyperPlus Kit
Sequencing: Illumina MiniSeq, 2×150 bp paired-end reads
Minimum depth: 500× coverage for variant calling

Controls:

Sequencing vector control: pCMV6-IDH1 R132H plasmid (Origene, TP300950)
Internal calibration: spike 5% mutant allele into wild-type DNA

PHASE 5: Bioinformatics Analysis and Variant Calling (Day 17-19)

5.1 Sanger Sequencing Analysis

Base calling: Sequencing Analysis Software v5.4 (Applied Biosystems)
Sequence alignment: Geneious Prime or Benchling
Variant calling: Compare to reference sequences (IDH1: NM_001609.4; IDH2: NM_002168.4)

5.2 NGS Data Analysis Pipeline

Quality control: FastQC v0.11.9
Alignment: BWA-MEM2 to GRCh38
Variant calling: GATK HaplotypeCaller (minimum quality score ≥30)
Filter variants: QD <2.0, FS >60.0, MQ <40.0
Annotation: ANNOVAR, dbSNP Build 153, COSMIC v99

5.3 Variant Classification

Pathogenic mutations: R132H, R132C, R132G, R132L, R132S (IDH1); R172K, R172M, R172G (IDH2)
Interpret using ACMG/AMP guidelines for variant classification
Protein structure validation: I-TASSER or AlphaFold2

PHASE 6: Statistical Analysis and Interpretation (Day 20-21)

6.1 Descriptive Statistics

Mutation frequency: percentage with 95% confidence intervals (Wilson score interval)
Stratify by: tumor type, WHO grade, patient age, sex, anatomical location

6.2 Comparative Analysis

Fisher's exact test for categorical variables
Chi-square test for trend across grades
Mann-Whitney U test for continuous variables (age)
Bonferroni correction for multiple comparisons (adjusted α = 0.05/6 = 0.0083)

6.3 Power Analysis

Sample size calculation: G*Power 3.1
Effect size estimation based on literature (IDH mutation frequency ~80% in astrocytomas, ~90% in oligodendrogliomas, ~10% in primary glioblastomas)
Target power: 0.80; α = 0.05

Expected Outcomes

CNS tumor cohort: IDH1/IDH2 mutation frequency of 75-85% in astrocytomas (WHO II-IV) and oligodendrogliomas, with R132H accounting for >80% of IDH1 mutations, consistent with TCGA and CBTTC datasets.

Non-CNS tumor cohort: IDH1/IDH2 mutation frequency of 2-5% across colorectal carcinoma (primarily R132C), 10-15% in cholangiocarcinoma (R132C/G), and 10-15% in AML (R172K), as reported in COSMIC and cBioPortal databases.

...

Success Criteria

Specimen quality: ≥90% of extracted DNA samples meet QC thresholds (260/280 ≥1.8, DIN ≥3.0). Failure to achieve this threshold triggers repeat extraction or sample exclusion.
PCR amplification: ≥95% of samples yield specific amplification product (single band on gel) for both IDH1 and IDH2 targets. Samples with non-specific amplification or failure after 3 attempts are excluded from sequencing.

...

Related Hypotheses (1)

Grid Cell-Specific Metabolic Reprogramming via IDH2 Enhancement0.646

Debate History (0)

No debates yet

Experiment Results (0)

No results recorded yet. Use POST /api/experiments/{id}/results to record a result.