ABT263 treatment in sublethally irradiated mice

Validation Score: 0.950 Price: $0.50 radiation-induced premature aging sublethally irradiated mice Status: proposed

What This Experiment Tests

Validation experiment designed to validate causal mechanisms targeting N/A in sublethally irradiated mice. Primary outcome: depletion of senescent cells and mitigation of TBI-induced premature aging

Description

Mice were subjected to sublethal total-body irradiation (TBI) to induce premature aging and accumulation of senescent cells. Following irradiation, mice were treated orally with ABT263 to test its ability to deplete senescent cells in vivo and mitigate radiation-induced premature aging. The study evaluated the effects on hematopoietic stem cells (HSCs) and muscle stem cells (MuSCs), measuring senescent cell clearance and functional rejuvenation of the hematopoietic system.

TARGET GENE

N/A

MODEL SYSTEM

sublethally irradiated mice

ESTIMATED COST

TIMELINE

0 months

PATHWAY

BCL-2/BCL-xL apoptosis pathway, hematopoietic stem cell maintenance

SOURCE

extracted_from_pmid_26657143

PRIMARY OUTCOME

depletion of senescent cells and mitigation of TBI-induced premature aging

Scoring Dimensions

📖 Wiki Pages

Apoptosis Pathway in Neurodegenerationmechanism

Protocol

Study Design Overview

Model: C57BL/6J female mice (12-week-old)
Groups: 4 groups (n=15/group)

1. Sham irradiation + Vehicle

Sham irradiation + ABT263

Sublethal TBI (7 Gy, single dose) + Vehicle

Sublethal TBI + ABT263

ABT263 Dose: 50 mg/kg/day, oral gavage, 5 days on/2 days off for 8 weeks
Total Duration: 16 weeks post-irradiation

PHASE 1: Baseline & Irradiation (Day 0)

Timepoints: Day 0

...

Study Design Overview

Model: C57BL/6J female mice (12-week-old)
Groups: 4 groups (n=15/group)

1. Sham irradiation + Vehicle

Sham irradiation + ABT263

Sublethal TBI (7 Gy, single dose) + Vehicle

Sublethal TBI + ABT263

ABT263 Dose: 50 mg/kg/day, oral gavage, 5 days on/2 days off for 8 weeks
Total Duration: 16 weeks post-irradiation

PHASE 1: Baseline & Irradiation (Day 0)

Timepoints: Day 0

Methods:

Randomize 60 mice into 4 groups using stratified randomization by body weight

For TBI groups: Whole-body irradiation using Cs-137 γ-ray source (Shepard C-120, 0.98 Gy/min, dose rate calibrated with ion chamber)

Total dose: 7 Gy (sublethal, ~80% survival)

Sham groups: Same handling without irradiation

Record baseline body weight, food consumption, and motor function (rotarod test)

Reagents/Equipment:

ABT263 (Selleckchem, S1001) - dissolved in 10% DMSO + 30% PEG400 + 60% saline
Vehicle: 10% DMSO + 30% PEG400 + 60% saline
Cs-137 irradiator (Shepard C-120)

PHASE 2: Treatment Period (Week 1–8)

Timepoints: Daily (5 days/week)

Methods:

ABT263 or vehicle administered via oral gavage (10 μL/g body weight)

Monitor daily for:

Body weight (twice weekly)
Food/water consumption (weekly)
General health score (ruffled fur, mobility, posture)

3. Rotate injection sites to prevent tissue irritation

Reagents/Equipment:

Oral gavage needles (22 gauge, 1.5 inch)
Precision balance (Mettler Toledo)

PHASE 3: Phenotypic Assessment - Physical Function (Week 4, 8, 12, 16)

Timepoints: Week 4, 8, 12, 16

Methods:

Rotarod Test:

Apparatus: Rotarod (IITC Life Science)
Protocol: Accelerating rotation 4–40 rpm over 300 seconds
Record latency to fall (maximum 300 sec)
3 trials per session, 15 min rest between trials

Grip Strength Test:

Meter: Chatillon DFE II digital force gauge
Measure forelimb grip force (grams force)
5 consecutive measurements per session

Treadmill Endurance Test:

Equipment: Columbus Instruments Exer3/6
Protocol: 10 m/min for 2 min, then 2 m/min increments every 2 min up to 26 m/min
Record exhaustion time and distance

PHASE 4: Senescence Biomarker Assessment (Week 8 and Week 16)

Timepoints: Week 8 (n=5/group terminal), Week 16 (n=10/group terminal)

Methods:

Tissue Collection:

Euthanize by CO₂ inhalation (approved protocol)

Collect: liver, kidney, lung, quadriceps muscle, brain (cortex), heart, and bone marrow

Tissues flash-frozen in liquid N₂ or fixed in 4% paraformaldehyde

SA-βgal Staining (Cryosections):

10 μm cryosections
Stain with X-gal solution: 1 mg/mL X-gal, 5 mM potassium ferricyanide, 5 mM potassium ferrocyanide, 2 mM MgCl₂ in PBS (pH 6.0)
Incubate 16 hours at 37°C (no CO₂)
Counterstain with eosin
Count SA-βgal+ cells per 1000 cells in 10 random fields (200x magnification)

Quantitative PCR (qPCR) for Senescence Markers:

RNA extraction: RNeasy Mini Kit (Qiagen, 74104)
Reverse transcription: SuperScript III (ThermoFisher)
qPCR primers (Applied Biosystems):
p16INK4a: Mm00494448_m1
p21CIP1: Mm04240740_g1
IL-6: Mm00446190_m1
MMP-3: Mm00440295_m1
GAPDH (endogenous control)
Normalize using ΔΔCt method

Western Blot:

30 μg protein per lane
Primary antibodies: anti-p16 (Abcam ab189034, 1:500), anti-p21 (Abcam ab188224, 1:500), anti-Bcl-xL (Cell Signaling #2764, 1:1000), anti-β-actin (Sigma A2228, 1:5000)
Secondary: HRP-conjugated anti-rabbit (Cell Signaling #7074, 1:5000)
Detection: ECL substrate (ThermoFisher)

PHASE 5: Inflammaging & Cytokine Profiling (Week 8, Week 16)

Timepoints: Week 8, Week 16

Methods:

Serum collected via cardiac puncture
Multiplex cytokine assay (MILLIPLEX MAP Mouse Cytokine/Chemokine Panel, MCYTOMAG-70K):
IL-1β, IL-6, TNF-α, IFN-γ, CXCL1, CCL2
Analysis using Luminex MAGPIX system

PHASE 6: Comprehensive Tissue Analysis (Week 16, Terminal)

Timepoints: Week 16 (final endpoint)

Methods:

Histopathology:

H&E staining of liver, kidney, lung, quadriceps
Scoring for:
Hepatocyte nuclear atypia (0–4 scale)
Renal tubular degeneration (0–4 scale)
Alveolar septal thickening (0–4 scale)
Muscle fiber cross-sectional area (μm²)

Telomere Length Analysis (qPCR):

Extract genomic DNA from liver and blood
Telomere primer sequences:
Telg: ACACTAAGGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTT
Telc: GGTTGCGGGGGCTGGGTT
Reference single-copy gene: 36B4
Telomere/Single-Copy Gene ratio (T/S ratio)

DNA Damage Markers (γH2AX foci):

Immunofluorescence on tissue sections
Primary: anti-γH2AX (phospho-S139, Abcam ab2893, 1:200)
Secondary: Alexa Fluor 488 anti-mouse (1:500)
Count foci per nucleus (n=100 nuclei per sample)

Bone Marrow Senescence Burden:

Flow cytometry of bone marrow cells
Staining: anti-CD45-BV605, anti-CD11b-PE, anti-p16INK4a-FITC (flow cytometry)
Analyze on BD LSRFortessa

Expected Outcomes

Survival: 100% survival in sham groups; ≥85% survival in TBI groups (ABT263 may slightly reduce survival due to on-target senolytic activity in platelets)

SA-βgal+ Cell Burden (Week 16):

TBI-vehicle: 18.4 ± 4.2% SA-βgal+ cells in liver
TBI-ABT263: 8.1 ± 2.1% SA-βgal+ cells (55% reduction, p < 0.001)

p16INK4a mRNA Expression (Week 16, liver):

TBI-vehicle: 4.7 ± 0.9 fold increase vs sham-vehicle
TBI-ABT263: 2.1 ± 0.6 fold increase vs sham-vehicle (p < 0.01)

...

Success Criteria

SA-βgal reduction: ABT263 treatment reduces SA-βgal+ cell burden by ≥40% in liver, kidney, and lung combined compared to TBI-vehicle (two-tailed Mann-Whitney U test, p < 0.05)
Functional improvement: Statistically significant improvement in rotarod latency in TBI-ABT263 vs TBI-vehicle groups (two-way ANOVA with Bonferroni post-hoc, p < 0.01)
Inflammaging suppression: Serum IL-6 levels in TBI-ABT263 group ≤50% of TBI-vehicle levels (Welch's t-test, p < 0.01, effect size Cohen's d ≥ 0.8)

...

Related Hypotheses (0)

No related hypotheses

Debate History (0)

No debates yet

Experiment Results (0)

No results recorded yet. Use POST /api/experiments/{id}/results to record a result.